Gregor Mendel was the one who proved genetic variations existed through cross breeding different species of pea plants. The discovery of genetic factors in species solidified Darwin's theory of evolution. (And gave John Herschel a good slap in the face for criticizing Darwin's theory). Mendel's experiments showed heritable mutations that were passed from parent to offspring could be present but not visible. Mendel's research greatly contributes to the modern day understanding of genetics.
2. Draw the DNA structure. Who discovered it?
The DNA structure was discovered by James D. Watson and Francis Crick
![]() |
| I tried you guys. |
Substitution of a single letter for another at a specific position in the polymer
AATCGAATCCGGAAT
AATCGATTCCGAAT
Deletion of a group of letters
AATCGAATCCGGAAT
AATCGAATCCGG
Duplication
AATCGAATCCGGAAT
AATCGAATCCGGAATAATAAT
Insertion of New Letters
AATCGAATCCGGAAT
AATCGAATCCGGAATTCG
Inversion and Translocation of already present letters
AATCGAATCCGGAAT
AACCAAATCTGGAGT
4. What is evo devo?
Evo Devo (Evolutionary Developmental Biology) is a specialized branch of within the field of evolutionary biology that focuses on studying the effects of changes in important developmental genes and how they affect evolution.
5. Make a connection between human migration and the mutation of lactose intolerant.
In many early cultures, milk was only fed during infancy. Because of the absence of milk in adulthood, a person develops lactose intolerance. If said person were to migrate to a region where milk is consumed into adulthood, he/she would be considered lactose intolerant because the body would not be used to the consumption of lactose.

No comments:
Post a Comment