Viruses are what!?! (A not so brief summary of Ch. 6 of Survival of the Sickest)

So, according to this book Survival of the Sickest, ⅓ of our DNA consists of viruses.

And I know what you're thinking, "I thought we were supposed to fight viruses and blah blah blah."

But believe it or not, not all viruses are bad. It's just like how not all bacteria is bad.

But we'll get back to that in a bit.

So, way back when during the time of "thee"s "thou"s and "thine"s (okay, maybe not that far back), a whole ton of people were dying from smallpox, except for milkmaids who had been infected with cowpox.

Now one might have screamed "witchcraft" and burned the milkmaids, but country doctor Edward Jenner saw this as a way to cure smallpox by using the cowpox virus, and thus the vaccine was born! (Fun fact, vaccine is actually derived from the Latin word "vacca" meaning cow)

Our DNA is 97% "junk". Only 3% of it contains instructions for building cells. But scientists later discovered that the other DNA wasn't junk after all.

One third of DNA consists of viruses and that is incredibly important, especially with evolution.

You see, there's this theory that French scientist Jean-Baptiste Lamark thought of called the inherited acquired traits theory. Basically, if your parents, let's say were bodybuilders, then you would also be born with guns of steel because your parents had guns of steel. And, oh my god was Lamark made fun of for that idea.

But he wasn't completely wrong.

Barbara McClintock discovered another part of the useless "junk DNA" called "jumping genes". Scientifically, they're known as transposons. These DNA move from one place to another due to environmental stress. They're basically like the "Oh my god I'm so screwed I haven't finished my history essay. Let me just copy and paste this from Wikipedia and be done." (DO NOT PLAGIARIZE EVER! THAT WAS A JOKE)

Transposons copy a certain DNA and moves it to another place while still keeping the original DNA in its place.

These"jumping genes" make up a huge amount of our DNA.

Now, you must be thinking, "Yeah cool this is perfect. Nothing will go wrong."

But that's also how people thought the United States Confederacy was going to be and we all know that that did not happen. (Let's be honest, the government right now isn't doing to well either.)

Humans get sick (and sometimes die) because viruses are also evil! Most viruses are made up of RNA, not DNA. However, these viruses (retroviruses) have this enzyme called reverse transcriptase (jeez I wonder what that does). This enzyme transcribes the virus from RNA into DNA and then go and take over a cell until that cell explodes and then there are so many of them that they're all over the place and your cells are exploding from left to right and…you're sick.

Dramatic right?

But viruses stop viruses! And that's why viruses are important and that's also why you should probably get your flu shot (but don't listen to me because I never get a flu shot).

Now here's the real question. How would you rather want the human race to be wiped out: nuclear war or super deadly mutant virus that takes over everything?

Day 20: Arts and Crafts!

Today we were taken back to our kindergarten years of arts and crafts. We were given four sheets of paper that had half of a DNA. We were supposed to use our extremely tiny safety scissors to carefully cut up the DNA pieces and stick them together with tape to make a paper model of a double helix.

But, a lot of us forgot what arts and crafts and fancy paper cutting is. I mean, its been a good ten years since someone gave us scissors and paper and told us to cut shapes. Cut us some slack. We're only sixteen.

So after the complicated cutting (I swear it's like performing surgery), we taped up the bases (A,C,T,G). The tape acted like hydrogen bonding: Three pieces of tape for C and G, and two pieces of tape for A and T.

It was so much harder than you'd think it would be.

The next class, we're going to be working with DNA replication, which means more cutting! Yay! I'm going to fail…

Until next time.

From Atoms to Traits (Article questions and answers)

1. Explain the significance of Mendel.

Gregor Mendel was the one who proved genetic variations existed through cross breeding different species of pea plants. The discovery of genetic factors in species solidified Darwin's theory of evolution. (And gave John Herschel a good slap in the face for criticizing Darwin's theory). Mendel's experiments showed heritable mutations that were passed from parent to offspring could be present but not visible. Mendel's research greatly contributes to the modern day understanding of genetics.

2. Draw the DNA structure. Who discovered it?

The DNA structure was discovered by James D. Watson and Francis Crick

I tried you guys. 

3. Explain each of the five examples of variations that occur to DNA and give an example of each.

Substitution of a single letter for another at a specific position in the polymer 

AATCGAATCCGGAAT

AATCGATTCCGAAT

Deletion of a group of letters                                                                                                             

AATCGAATCCGGAAT                 

AATCGAATCCGG

Duplication                                                                                                                                             

AATCGAATCCGGAAT                 

AATCGAATCCGGAATAATAAT

Insertion of New Letters                                                                                                                            

AATCGAATCCGGAAT                 

AATCGAATCCGGAATTCG

Inversion and Translocation of already present letters                                                                                 

AATCGAATCCGGAAT                 

AACCAAATCTGGAGT

4. What is evo devo?

Evo Devo (Evolutionary Developmental Biology) is a specialized branch of within the field of evolutionary biology that focuses on studying the effects of changes in important developmental genes and how they affect evolution. 

5. Make a connection between human migration and the mutation of lactose intolerant.

In many early cultures, milk was only fed during infancy. Because of the absence of milk in adulthood, a person develops lactose intolerance. If said person were to migrate to a region where milk is consumed into adulthood, he/she would be considered lactose intolerant because the body would not be used to the consumption of lactose. 

Day 19: Movie Day 2.0

So today, we finished up the PBS documentary Journey Of Man. 

The movie follows Dr. Spencer Wells as he travels the world to find out how humans came to take over the earth. 

The oldest human fossils pointed him to Africa. There he met the San tribe, also called Bushmen, the oldest African tribe in existence. Wells hypothesized that the early humans that left Africa were part of the San tribe. 

You can see from the picture that the San tribe has many facial features that are similar to other ethnic groups around the world. The nose and lips are African, the eyes are Asian, the chin and cheek bones are Caucasian. 

Wells believed that a group of San Bushmen left their tribe and left Africa through the Middle East. There, a group split and followed the coast, moving through India, and the Indonesian Islands until they reached Australia. The direct descendants of the people that first migrated to Africa are the Aboriginal tribes. (Although there is scientific evidence to back up the theory that the Aboriginal people came from Africa, the tribesmen staunchly believe in their own creation and refuse to consider anyone else's. Just thought you'd like to know in case you meet one of them someday.)

In order to prove that the future Aussies followed the Asian coastline, Wells' next stop was a town in South India (I couldn't catch the name, sorry). There, he analyzed the DNA from local villagers and attempted to find similarities between the Australian Aboriginals and the San Bushmen. Lo and behold he found it all right. (I mean, the documentary wouldn't exist if he hadn't.)

So he established how people came about in India, the Asian Islands, and Australia. Next he followed, the second branch of people that left Africa and traced them to Kazakhstan. There, he met the man who was a direct descendant from the group that later split in three ways, Europeans, Northern Asians (and later Native Americans), and Indians. 

Wells then went north into the furthest and coldest part of Russia to meet the Chukchi people. These were Nomadic people that live near the Bering Strait. During the Ice Age, these people would have been able to cross the Arctic Ocean into Alaska and go down into North America and later South America. 

Wells concluded his journey in Arizona, where he discussed his findings with some Navajo Indians that lived on the reservation. 

He went around the world, starting from Africa, going into India, Australia, Europe, Asia, and the Americas, following the trail that our ancestors left.

Pretty dramatic, huh? That's exactly how the documentary seemed. But overall it was pretty cool. 

Until next time. 

Does Race Exist? (A Response to a Scientific Article of the Same Name)

Human race is a predefined concept to identify a group of humans based on their physical features and geographical origin. Science proves that race exists to a extent, but it is not an accurate way to group a species. In order to classify humans, scientists use tiny genetic variations in a genome called polymorphisms. A specific polymorphism that scientists use is called an Alus, which is a short piece of DNA that is of similar sequence to another Alus. The Alus replicates occasionally. For example, if a specific Alus was inherited from parent to offspring, that Alus would continue to show up in the genes of later generations of that same group. So obviously, if two people have the same Alus, then they share a common ancestor. However, the Alus is not an accurate way of classifying a human into a specific group. One would need sixty Alus polymorphisms to assign an individual to his/her continent of origin with ninety percent accuracy. In order to be completely sure, one would need one hundred Alus polumorphisms. This type of genetic analysis can distinguish groups of people according to their geographic origin, but it can only be used in populations of maximum genetic variation.

            Race is primarily distinguished by skin color and other physical features that have changed according to the environment that certain groups live in (natural selection). Genetically speaking, groups with similar physical features can have very different genes and vice versa. For example, the San people in Africa have the skin of an African, the eyes of an Asian, and the cheek and chin bones of a Caucasian. Their physical features are similar to that of three other races. Therefore, similar physical features due to natural selection are not strong indicators of genetic variation.

            Race is theoretically non-existent in the world of science. A person’s physical features may reveal his/her geographical origin, but it does not define who they’re closely related to and who their genetic common ancestor was. While, socially, race exists to classify groups of people, it is not that simple in science. 

Day 18: Why am I so Stupid!?!?! (Test Review Day...and other things)

Hey all!

So today, we got our test back and I got a 93%! Yay!

And I looked back to see what I got wrong and *face palm*

I was so stupid! I read a question wrong, completely blanked on another question, and guessed on another! Gahh!!

So, to prove to you, and my teacher, that I am not entirely an idiot, here's all the stupidity that went into my failure of Standard SP 2/5 and what I learned from it.


On the Unit 2 test, I got 1 out of 4 questions (numbers 25-28) for this standard right (which is why I got a 3).

Number 25 on the test  talked about similar animals that look the same and live in similar habitats but aren't very closely related. This is called convergent evolution. I'd put adaptive radiation because of the "adaptive" part, but "radiation" made no sense now that I look back at it. I now know what convergent evolution is!

Number 26: Yay! I got it right!

Number 27: I actually knew the answer to this one but I read the question wrong! Instead of reading "which of the following [adaptations] would least likely be observed, I thought it said "most likely". This question talked about how algae-eating fish had a predator that relied on vision to hunt. In order for the algae to survive, they needed to adapt so that it was harder to see them. And that's where I messed up my answer. Come on! "least likely" definitely does not mean "most likely". The correct answer to that is that the female algae eaters may become larger, bearing broods composed of more, and larger, young. Because that is definitely not going to happen.

Number 28 asked what would happen to a population if it was separated by a river and split into two populations that cannot interbreed. Now, I'm pretty sure we did not learn the exact name for this, but it was definitely in one of our labs so, I guess it's my fault for not figuring it out. I went for the most outrageous answer "Lamarckian evolution" and I'm pretty sure that's not an actual thing. The correct answer was "speciation".

Yup...I'm smart.

After that, we started watching a documentary on a man's journey to find the roots to early man and why they might have left Africa. It's made with hilarious '90s effects that probably looked cool at the time. So far it's pretty interesting. We haven't finished it yet, so I'll have more stuff on it in the next post.

Until next time.

Day 17: Test Day!!

Okay, I'm not going to lie. That test had me at wit's end for most of the week. I was freaking out.  I think I might have collapsed from sheer exhaustion and anxiety maybe twice. This week was just way to hectic.

So the test itself wasn't too bad. I read three questions wrong so I know I got those wrong (stupid!). There's a standard that I need to bring up, which I will do as soon as I get my test back. And, I probably should start slowly studying about a week before the next test. But let's be honest, knowing me it's probably not going to happen.

But I got an A on the test, so that means my overall grade should be an A- (hopefully). So now, after a long and early Saturday (PSATs suck!) I'm going to head to bed...after I finish more work.

Until next time.

Day 16: Mating (and the awkward atmosphere that came with it)

Warning number 2: This class contained uncomfortably awkward music and actions. If you do not wish the cringe at teenage awkwardness, well that sucks because adults are just as awkward, so get over it. 

Today's class consisted off two things that I do not do under any circumstances. Taste an unknown chemical, and "mingle".

But we'll get to that later. 

Before I nearly lost my life (or well, I could have), we reviewed what we had learned in class earlier and were introduced to new things. (I'm being vague because I don't want to give it away!)

Mind maps!!! 

So we have physics traits. No duh, everyone does. But there are two kinds of traits, dominant and recessive. These traits are determined by our genotype, which is a set of genes that an organism carries. Our genes can either be homozygous dominant, homozygous recessive, or heterozygous. These genes are determined by the population. The physical traits that show because of the genotype are called phenotypes. Phenotypes are also dominant or recessive. These traits have many different variations that prove natural selection, "survival of the fittest", and evolution. The variations in traits can be found in proteins, DNA, and genes, and are the biochemical evidence of natural selection. In order to find the frequency of the gene and the percent population, two people Godfrey H. Hardy and Wilhelm Weinberg created a formula to solve that, creatively named the Hardy-Weinberg Principle.

Hardy and Weinberg looked at the dominant and recessive alleles in genes and created an equation that had an uncanny resemblance to the Pythagorean Theorem. (Come on you guys. The Pythagorean Theorem is so three thousand years ago.)

By using this theorem, one can find the frequency of the gene and percent population of the gene in a population. ( I would give examples, but blogger won't let me up equations in...)

Now here's the awkward part. In order to test genetic frequency and percent populations, the class was given four flash cards each, two with a capital 'A' and two with a lower case 'a'. We were then told to exchange two card each to create an offspring, thus "mating" with one another. 

To make things worse, there was mood music playing. The music fell into the same category of songs like "Let's Get it On", "Careless Whisper", and "Business Time". 

I learned three things from that.

1. I'm an awkward dancer
2. "Mating" is not my thing.
3. Evolution occurs when there is change in the genotype of a population. 

To go further into depth on number three, as we continued "mating" and such, there were less and less people with the 'aa' or recessive gene and more and more people with either the 'AA' or 'Aa' dominant gene. The species were slowly adapting to the environment that surrounded them so that more can live. 

And that my friends, is evolution in a nutshell.

So I've got a test next class and I know I said last time that next time I'll start studying before the night before the test...but a nasty AP U.S. History test and a dreadful AP Lang essay got in the way of that. So, yay cramming!!

Until next time.