From Atoms to Traits (Article questions and answers)

1. Explain the significance of Mendel.

Gregor Mendel was the one who proved genetic variations existed through cross breeding different species of pea plants. The discovery of genetic factors in species solidified Darwin's theory of evolution. (And gave John Herschel a good slap in the face for criticizing Darwin's theory). Mendel's experiments showed heritable mutations that were passed from parent to offspring could be present but not visible. Mendel's research greatly contributes to the modern day understanding of genetics.

2. Draw the DNA structure. Who discovered it?

The DNA structure was discovered by James D. Watson and Francis Crick

I tried you guys. 

3. Explain each of the five examples of variations that occur to DNA and give an example of each.

Substitution of a single letter for another at a specific position in the polymer 

AATCGAATCCGGAAT

AATCGATTCCGAAT

Deletion of a group of letters                                                                                                             

AATCGAATCCGGAAT                 

AATCGAATCCGG

Duplication                                                                                                                                             

AATCGAATCCGGAAT                 

AATCGAATCCGGAATAATAAT

Insertion of New Letters                                                                                                                            

AATCGAATCCGGAAT                 

AATCGAATCCGGAATTCG

Inversion and Translocation of already present letters                                                                                 

AATCGAATCCGGAAT                 

AACCAAATCTGGAGT

4. What is evo devo?

Evo Devo (Evolutionary Developmental Biology) is a specialized branch of within the field of evolutionary biology that focuses on studying the effects of changes in important developmental genes and how they affect evolution. 

5. Make a connection between human migration and the mutation of lactose intolerant.

In many early cultures, milk was only fed during infancy. Because of the absence of milk in adulthood, a person develops lactose intolerance. If said person were to migrate to a region where milk is consumed into adulthood, he/she would be considered lactose intolerant because the body would not be used to the consumption of lactose.