Day 31: It was that day

So when I was in sixth grade, I was low-key obsessed with Twilight. And when I say "low-key", I mean the exact opposite of that. I know, embarrassing right?

Anyways, in that sorry excuse of a book, there is this scene where Bella and Edward are looking at different cells and chatting and naming all the phases of mitosis.

Well, I didn't know that back in sixth grade but I know that now because that's exactly what we did in class today. And the only thing I could think of the entire bloody time was Twilight.

We looked at the different phases of mitosis, trying to find interphase (which is almost every single cell), prophase (which looks exactly like interphase but isn't), metaphase (which looks like the nucleus turned into a spider), anaphase (where the spider looks like it's being surrounded by a bunch of mini worm things), and telophase (where two cells are better than one)

We looked at plant cells (the same kind of plant cell as Twilight….

Lookie!! I see metaphase! and interphase!

And then we looked at animal cells, which to be quite honest, looked like splotches.

It just looks like blob...

One week until Christmas break!! 

Until next time. 

Your Inner Fish Chapter 6 review

What is embryology?

Well, embryos are the little pre-fetus things that grow inside the mom after conception. Wow that was so sophisticated. So embryology is the study of the pre-fetus things! Embryology focuses on the development after fertilization. Turns out, a lot of the embryos look very similar during early stages.

In embryonic development, there are three germ layers: endoderm, mesoderm, and ectoderm.

The endoderm is the innermost layer and consists of flattened cells and develops the digestive organs such as the stomach, liver, and intestines, and the lungs.

Mesoderm is the middle layer and it develops the muscles, blood system, and skeleton. The layer is formed through a process called gastrulation in the third week of embryonic development.

The exterior layer is called ectoderm and it helps form the nervous system, meaning the spine, brain, and peripheral nerves. It also forms the lining of the mouth, nostrils, anus, sweat glands, hair, and nails.

*Fun fact: ectoderm means "outside skin" in Greek. Those smarty pants!*

DNA control plays a huge role in embryonic development. The DNA control regulates and shows how the the genes operate together.

When everything goes right, you end up with a tiny living thing!

Day 29/30: That's my life, slowly ending/"I'm a Survivor!!"

Day 29

Test day. Ugh. So tired. Need sleep.

Day 30

You guys!! I did so well on the last test. I should stay up until 3am before test days more often! (Hahaha, no. Never again.)

So we got our tests back and the only thing I really screwed up on was the Hardy Weinberg part, but I fixed it so it's all good!

And now, we move onto cytology!

Cytology is the study of cells. (I just looked that up.) And the first thing we did in class was figure out how microscopes worked.

We had two kinds microscopes: the fancy digital kind, and the normal kind. To be quite honest, I liked the normal kind more.

We looked at cheek cells (provided by yours truly) and leaf cells

Cheek cells! Look at all that crap in my mouth!

Plant cells. So nice and in a line and organized. Kind of like a prison cell…oh wait. 

Day 28: Pedigrees!!! And other things...

Bear with me everyone. It's 2 in the morning.

Last class, we were wrapping up our genetics unit by learning about the visual complexity that is the pedigree. And no I'm not talking about the dog food brand.

A pedigree is basically a visual representation of the Punnett Square, except I like the pedigree better!

With pedigrees, you can calculate all the fancy statistics and figure out if the gene/mutation/disease is autosomal or sex-linked, and dominant or recessive.

Here's a fine example of a pedigree

With this graph, you can determine the traits of parents and their offspring really easily.
Aaaand that's basically it. There's a test next class so we all know that I'll be freaking out and being very overdramatic about the entire thing, calm down a bit, and then start up again when I get the test back. I hope it's entertaining for you all.

Until next time.

Day 27: Turkey Day!! (Sort of, not really.)

Hi guys. I hope everyone had a great Thanksgiving. Hope you filled yourself up with that turkey tryptophan. I didn't because I'm a vegetarian but who cares!

Since I started writing this on Thanksgiving, I'm going to keep the name "Turkey Day" as the title.

Here's what happened the last class before break.

There was corn involved. Fitting don't you think?

We had to find the genotype and phenotype of multicolored corn, and let me tell you it's a lot harder than it looks.

The corn looked something like this

So we had to count the individual grains and figure out the ratio between the different colored grains.

In other news, we worked on some more genetic problem solving, which as always makes me question why I ever decided that biology is my favorite subject. I've been able to get it, but it's taking a while. Not everything's clicked together yet.

Well, it better start clicking because I've got a test on all this on Friday.

So, until next time.

Day 25/26: It's Genetics!

So I have a friend named Jeanette, and she's really tall and I'm really short. And I sometimes this frustrates me a lot. I can't reach so many things.

 So sometimes I ask her, "Why are you so tall?"

And she always replies, "Jeanette-ics"

*ba-doomsh*

So, yay we're moving onto genetics, which ties into our previous chapter of molecular biology! And guess what we brought back from the dark days of middle school, that's right, Punnett Squares!

So Day 25

We took a lot of notes about the genetic process and how DNA replication ties into this. We learned quite a bit of complicated vocabulary like phenotype (trait) and genotype (gene). Most importantly, we learned the six steps to figuring out the genotype and phenotype of a trait. (It involves math….)

Step 1
Write down EVERYTHING you know.

Step 2
Write the genotype of the parents

Step 3
Gametes
Involves the Law of Segregation.
Basically, you split the two chromatids that make up the gene.

Step 4
Punnett Squares
Slap those chromatids onto that square!

Step 5
Fill in the Punnett square

Step 6
Find the ratios of the phenotype and genotype.

The next class day, we applied it. Except this time, it was with two genes, which made life slightly more difficult and involved a larger Punnett Square.

Soon, you'll get to see the result of a Thanksgiving Break project on genetic diseases. Stay tuned.

Until next time.

Rusting to Death (A "News Report" on Chapter 1 of Survival of the Sickest)

Famous runner, Aran Gordon, had finished the Marathon des Sables for the second time. It was reported that just five years ago, Gordon’s death was predicted.

Gordon has hemochromatosis, which is a genetically inherited mutation that causes an excess buildup of iron in the blood stream.

As Dr. Sharon Moalem had stated, “Aran Gordon was rusting to death.”

Hemochromatosis a genetic mutation that causes the excess buildup of iron in the bloodstream and if it remains untreated, in major organs and joints.

In order to find purpose for this genetic mutation, Dr. Moalem researched hemochromatosis and found that excess iron is distributed everywhere except for a type of white blood cell called macropages. Bacteria use the iron in macropages to reproduce and survive. With deficit levels of iron in hemochromatic macropages, bacteria could not stay alive long enough to infect the body.

So, hemochromatosis was useful at some point in time, but now how do you prevent it from killing you? There is a way to prevent it, but its archaic medicine. It’s bloodletting, or in other words purging blood.

Blood purging had been given a bad reputation throughout the years, especially since before there was any scientific means of medicine, almost all illnesses were treated through blood purging.

Blood purging actually works with hemochromatosis and Aran Gordon is living proof of that.

So congrats to Aran Gordon for finishing the Marathon des Sables for the second time and overcoming hemochromatosis.

Day 24: Test Day #3 (help!)

I'm dead.

This is my last blog post. When my parents see my grade, I'll be lucky if I live to tell the tale.

Since I haven't gotten my test back yet, I can't exactly say what I did wrong, so I'll just let you know what happened during the test.

I actually felt like I knew what I was doing, mostly. And then all the technical questions came and the amount of profanity that was spiraling in my brain would have gotten my brain washed with soap.

I was done for.

So now, I am dead and dying, waiting to pass onto the next life, or the next test, which will hopefully be better.

Until next time.

Protein Synthesis Review Questions

*side note: Hi everyone, I know I haven't posted the daily class blog posts in a bit but we're doing a really big lab right now and I want to post the entire lab in one post so bear with me. We're almost done!*

Explain the following images in terms of what you (the student, so me) have learned from Survival of the Sickest and Your Inner Fish respectively.

The coloration of this flower is completely natural (though some may believe otherwise). Due to a "genetic mistake" or mutation, the flower is two different colors, giving it a unique appearance because of the rearrangement of DNA in the mutation. A lot of things could have caused this mutation, including outside radiation from either manmade chemicals or the sun's UV rays or it could just be a genetic miracle. 

Cool looking right? Yeah, it probably isn't for whoever that hand belongs to. This is a prime example of what happens when your Sonic hedgehog gene goes a bit haywire. The ZPA was manipulated in a way that it formed more digits than necessary. This is all due to an error in the hedgehog gene, which controls the structure of an animal's limbs.

Day 21/22/23: Lab Days!

Here's the lab day(s) post you have all been waiting for!

And guess which potentially harmful germ we dealt with: E coli!

Don't worry, it was completely harmless.

Basically, we were testing the gene regulation in the E coli bacteria by inserting arabinose and GFP (glowing genes). Except, most of us didn't know that yet. We all thought we were going to die.

There were four different petri dishes with different environments. One just had the E coli bacteria, one had the E coli bacteria and ampicilin, another had the bacteria, ampicilin, and the GFP, and the last one had everything: the E coli, ampicilin, arabinose, and GFP.

We did a lot of heating and cooling (pictures below) and then we stored our bacteria in an incubator. And then, we waited.

E coli with arabinose. It glowed! Sorry for the bad picture

So during the next few classes, we evaluated our outcome.

All of the bacteria grew in all the petri plates, but only the one with arabinose glowed.



Why you may ask? The operon system!

Am I going to explain to you what it is? Heck no! Not here anyways. That's what my next lab report is going to be on. The link will be in my next blog post.

Next class, it's test day.

Until next time.

Sonic Hedgehog!! (A Summary of Ch. 3 of Your Inner Fish)

Would you believe it if I told you that every animal is somehow related to each other?

Well, it's sort of true, and scientists are still figuring out a lot of really important chunks of that theory, but most discoveries of genetic similarities between different species are very recent, like 90's recent. Now, I don't know what you looked like back then, but I couldn't eat my food without it drooling down my chin back in the 90's.

Neal Shubin's (the guy who wrote Your Inner Fish) coworker, Randy Dahn, wanted to test DNA in sharks. In order to do that, Dahn first needed to understand ZPA tissues. These tissues showed that the relationship between living animals and fossils are based on more than just anatomy. The study of fossils and DNA go hand in hand actually. Shubin even says so when commenting that his research lab was split into two sections: fossils and DNA existing peacefully together in the realm of science.

The second part of Shubin's lab was DNA and the study of embryonic development. According to Shubin, most of our cells have the same copy of DNA.

Also, our limbs exist in three dimensions. Now, you're probably going "What the heck does that mean? We live in a 3D world. Of course we're in 3D." Well, maybe if you'd hold on for a bit, I'd tell you what it means.

Our limbs exist in three dimensions: a top and bottom, a pinky side and a thumb side, and a base and a tip. Our body develops limbs in this certain structure because of the chemicals produced by cells in a developing body. Researchers discovered that a certain portion of cells in the body controlled all limb development. If the cells were removed, all limb development would stop. If you cut the patch of cells in half, two limbs would develop.

Scientists had tested this hypothesis on chicken eggs and wanted to see if the same would happen to other animals, so they turned their attention to the fruit fly and found the hedgehog. The hedgehog is a gene within the ZPA tissues that control limb development. When scientists discovered the hedgehog in chickens, they rechristened it the Sonic hedgehog (because they saw the chance, and they took it.) The Sonic hedgehog gene could be manipulated by a Vitamin A injection, resulting in the change of how the limb develops.

And that's where Randy Dahn came into play. Dahn wanted to see if the sonic hedgehog was true for even the most different of animals, so he decided to test his theory on shark embryos. And hey, it worked!

Every animal has a sonic hedgehog gene. Every animal obtained their limbs from one animal and then branched out into many many different animals, which brings me back to my first point that we're all sort of related!

Viruses are what!?! (A not so brief summary of Ch. 6 of Survival of the Sickest)

So, according to this book Survival of the Sickest, ⅓ of our DNA consists of viruses.

And I know what you're thinking, "I thought we were supposed to fight viruses and blah blah blah."

But believe it or not, not all viruses are bad. It's just like how not all bacteria is bad.

But we'll get back to that in a bit.

So, way back when during the time of "thee"s "thou"s and "thine"s (okay, maybe not that far back), a whole ton of people were dying from smallpox, except for milkmaids who had been infected with cowpox.

Now one might have screamed "witchcraft" and burned the milkmaids, but country doctor Edward Jenner saw this as a way to cure smallpox by using the cowpox virus, and thus the vaccine was born! (Fun fact, vaccine is actually derived from the Latin word "vacca" meaning cow)

Our DNA is 97% "junk". Only 3% of it contains instructions for building cells. But scientists later discovered that the other DNA wasn't junk after all.

One third of DNA consists of viruses and that is incredibly important, especially with evolution.

You see, there's this theory that French scientist Jean-Baptiste Lamark thought of called the inherited acquired traits theory. Basically, if your parents, let's say were bodybuilders, then you would also be born with guns of steel because your parents had guns of steel. And, oh my god was Lamark made fun of for that idea.

But he wasn't completely wrong.

Barbara McClintock discovered another part of the useless "junk DNA" called "jumping genes". Scientifically, they're known as transposons. These DNA move from one place to another due to environmental stress. They're basically like the "Oh my god I'm so screwed I haven't finished my history essay. Let me just copy and paste this from Wikipedia and be done." (DO NOT PLAGIARIZE EVER! THAT WAS A JOKE)

Transposons copy a certain DNA and moves it to another place while still keeping the original DNA in its place.

These"jumping genes" make up a huge amount of our DNA.

Now, you must be thinking, "Yeah cool this is perfect. Nothing will go wrong."

But that's also how people thought the United States Confederacy was going to be and we all know that that did not happen. (Let's be honest, the government right now isn't doing to well either.)

Humans get sick (and sometimes die) because viruses are also evil! Most viruses are made up of RNA, not DNA. However, these viruses (retroviruses) have this enzyme called reverse transcriptase (jeez I wonder what that does). This enzyme transcribes the virus from RNA into DNA and then go and take over a cell until that cell explodes and then there are so many of them that they're all over the place and your cells are exploding from left to right and…you're sick.

Dramatic right?

But viruses stop viruses! And that's why viruses are important and that's also why you should probably get your flu shot (but don't listen to me because I never get a flu shot).

Now here's the real question. How would you rather want the human race to be wiped out: nuclear war or super deadly mutant virus that takes over everything?

Day 20: Arts and Crafts!

Today we were taken back to our kindergarten years of arts and crafts. We were given four sheets of paper that had half of a DNA. We were supposed to use our extremely tiny safety scissors to carefully cut up the DNA pieces and stick them together with tape to make a paper model of a double helix.

But, a lot of us forgot what arts and crafts and fancy paper cutting is. I mean, its been a good ten years since someone gave us scissors and paper and told us to cut shapes. Cut us some slack. We're only sixteen.

So after the complicated cutting (I swear it's like performing surgery), we taped up the bases (A,C,T,G). The tape acted like hydrogen bonding: Three pieces of tape for C and G, and two pieces of tape for A and T.

It was so much harder than you'd think it would be.

The next class, we're going to be working with DNA replication, which means more cutting! Yay! I'm going to fail…

Until next time.

From Atoms to Traits (Article questions and answers)

1. Explain the significance of Mendel.

Gregor Mendel was the one who proved genetic variations existed through cross breeding different species of pea plants. The discovery of genetic factors in species solidified Darwin's theory of evolution. (And gave John Herschel a good slap in the face for criticizing Darwin's theory). Mendel's experiments showed heritable mutations that were passed from parent to offspring could be present but not visible. Mendel's research greatly contributes to the modern day understanding of genetics.

2. Draw the DNA structure. Who discovered it?

The DNA structure was discovered by James D. Watson and Francis Crick

I tried you guys. 

3. Explain each of the five examples of variations that occur to DNA and give an example of each.

Substitution of a single letter for another at a specific position in the polymer 

AATCGAATCCGGAAT

AATCGATTCCGAAT

Deletion of a group of letters                                                                                                             

AATCGAATCCGGAAT                 

AATCGAATCCGG

Duplication                                                                                                                                             

AATCGAATCCGGAAT                 

AATCGAATCCGGAATAATAAT

Insertion of New Letters                                                                                                                            

AATCGAATCCGGAAT                 

AATCGAATCCGGAATTCG

Inversion and Translocation of already present letters                                                                                 

AATCGAATCCGGAAT                 

AACCAAATCTGGAGT

4. What is evo devo?

Evo Devo (Evolutionary Developmental Biology) is a specialized branch of within the field of evolutionary biology that focuses on studying the effects of changes in important developmental genes and how they affect evolution. 

5. Make a connection between human migration and the mutation of lactose intolerant.

In many early cultures, milk was only fed during infancy. Because of the absence of milk in adulthood, a person develops lactose intolerance. If said person were to migrate to a region where milk is consumed into adulthood, he/she would be considered lactose intolerant because the body would not be used to the consumption of lactose. 

Day 19: Movie Day 2.0

So today, we finished up the PBS documentary Journey Of Man. 

The movie follows Dr. Spencer Wells as he travels the world to find out how humans came to take over the earth. 

The oldest human fossils pointed him to Africa. There he met the San tribe, also called Bushmen, the oldest African tribe in existence. Wells hypothesized that the early humans that left Africa were part of the San tribe. 

You can see from the picture that the San tribe has many facial features that are similar to other ethnic groups around the world. The nose and lips are African, the eyes are Asian, the chin and cheek bones are Caucasian. 

Wells believed that a group of San Bushmen left their tribe and left Africa through the Middle East. There, a group split and followed the coast, moving through India, and the Indonesian Islands until they reached Australia. The direct descendants of the people that first migrated to Africa are the Aboriginal tribes. (Although there is scientific evidence to back up the theory that the Aboriginal people came from Africa, the tribesmen staunchly believe in their own creation and refuse to consider anyone else's. Just thought you'd like to know in case you meet one of them someday.)

In order to prove that the future Aussies followed the Asian coastline, Wells' next stop was a town in South India (I couldn't catch the name, sorry). There, he analyzed the DNA from local villagers and attempted to find similarities between the Australian Aboriginals and the San Bushmen. Lo and behold he found it all right. (I mean, the documentary wouldn't exist if he hadn't.)

So he established how people came about in India, the Asian Islands, and Australia. Next he followed, the second branch of people that left Africa and traced them to Kazakhstan. There, he met the man who was a direct descendant from the group that later split in three ways, Europeans, Northern Asians (and later Native Americans), and Indians. 

Wells then went north into the furthest and coldest part of Russia to meet the Chukchi people. These were Nomadic people that live near the Bering Strait. During the Ice Age, these people would have been able to cross the Arctic Ocean into Alaska and go down into North America and later South America. 

Wells concluded his journey in Arizona, where he discussed his findings with some Navajo Indians that lived on the reservation. 

He went around the world, starting from Africa, going into India, Australia, Europe, Asia, and the Americas, following the trail that our ancestors left.

Pretty dramatic, huh? That's exactly how the documentary seemed. But overall it was pretty cool. 

Until next time. 

Does Race Exist? (A Response to a Scientific Article of the Same Name)

Human race is a predefined concept to identify a group of humans based on their physical features and geographical origin. Science proves that race exists to a extent, but it is not an accurate way to group a species. In order to classify humans, scientists use tiny genetic variations in a genome called polymorphisms. A specific polymorphism that scientists use is called an Alus, which is a short piece of DNA that is of similar sequence to another Alus. The Alus replicates occasionally. For example, if a specific Alus was inherited from parent to offspring, that Alus would continue to show up in the genes of later generations of that same group. So obviously, if two people have the same Alus, then they share a common ancestor. However, the Alus is not an accurate way of classifying a human into a specific group. One would need sixty Alus polymorphisms to assign an individual to his/her continent of origin with ninety percent accuracy. In order to be completely sure, one would need one hundred Alus polumorphisms. This type of genetic analysis can distinguish groups of people according to their geographic origin, but it can only be used in populations of maximum genetic variation.

            Race is primarily distinguished by skin color and other physical features that have changed according to the environment that certain groups live in (natural selection). Genetically speaking, groups with similar physical features can have very different genes and vice versa. For example, the San people in Africa have the skin of an African, the eyes of an Asian, and the cheek and chin bones of a Caucasian. Their physical features are similar to that of three other races. Therefore, similar physical features due to natural selection are not strong indicators of genetic variation.

            Race is theoretically non-existent in the world of science. A person’s physical features may reveal his/her geographical origin, but it does not define who they’re closely related to and who their genetic common ancestor was. While, socially, race exists to classify groups of people, it is not that simple in science. 

Day 18: Why am I so Stupid!?!?! (Test Review Day...and other things)

Hey all!

So today, we got our test back and I got a 93%! Yay!

And I looked back to see what I got wrong and *face palm*

I was so stupid! I read a question wrong, completely blanked on another question, and guessed on another! Gahh!!

So, to prove to you, and my teacher, that I am not entirely an idiot, here's all the stupidity that went into my failure of Standard SP 2/5 and what I learned from it.


On the Unit 2 test, I got 1 out of 4 questions (numbers 25-28) for this standard right (which is why I got a 3).

Number 25 on the test  talked about similar animals that look the same and live in similar habitats but aren't very closely related. This is called convergent evolution. I'd put adaptive radiation because of the "adaptive" part, but "radiation" made no sense now that I look back at it. I now know what convergent evolution is!

Number 26: Yay! I got it right!

Number 27: I actually knew the answer to this one but I read the question wrong! Instead of reading "which of the following [adaptations] would least likely be observed, I thought it said "most likely". This question talked about how algae-eating fish had a predator that relied on vision to hunt. In order for the algae to survive, they needed to adapt so that it was harder to see them. And that's where I messed up my answer. Come on! "least likely" definitely does not mean "most likely". The correct answer to that is that the female algae eaters may become larger, bearing broods composed of more, and larger, young. Because that is definitely not going to happen.

Number 28 asked what would happen to a population if it was separated by a river and split into two populations that cannot interbreed. Now, I'm pretty sure we did not learn the exact name for this, but it was definitely in one of our labs so, I guess it's my fault for not figuring it out. I went for the most outrageous answer "Lamarckian evolution" and I'm pretty sure that's not an actual thing. The correct answer was "speciation".

Yup...I'm smart.

After that, we started watching a documentary on a man's journey to find the roots to early man and why they might have left Africa. It's made with hilarious '90s effects that probably looked cool at the time. So far it's pretty interesting. We haven't finished it yet, so I'll have more stuff on it in the next post.

Until next time.

Day 17: Test Day!!

Okay, I'm not going to lie. That test had me at wit's end for most of the week. I was freaking out.  I think I might have collapsed from sheer exhaustion and anxiety maybe twice. This week was just way to hectic.

So the test itself wasn't too bad. I read three questions wrong so I know I got those wrong (stupid!). There's a standard that I need to bring up, which I will do as soon as I get my test back. And, I probably should start slowly studying about a week before the next test. But let's be honest, knowing me it's probably not going to happen.

But I got an A on the test, so that means my overall grade should be an A- (hopefully). So now, after a long and early Saturday (PSATs suck!) I'm going to head to bed...after I finish more work.

Until next time.

Day 16: Mating (and the awkward atmosphere that came with it)

Warning number 2: This class contained uncomfortably awkward music and actions. If you do not wish the cringe at teenage awkwardness, well that sucks because adults are just as awkward, so get over it. 

Today's class consisted off two things that I do not do under any circumstances. Taste an unknown chemical, and "mingle".

But we'll get to that later. 

Before I nearly lost my life (or well, I could have), we reviewed what we had learned in class earlier and were introduced to new things. (I'm being vague because I don't want to give it away!)

Mind maps!!! 

So we have physics traits. No duh, everyone does. But there are two kinds of traits, dominant and recessive. These traits are determined by our genotype, which is a set of genes that an organism carries. Our genes can either be homozygous dominant, homozygous recessive, or heterozygous. These genes are determined by the population. The physical traits that show because of the genotype are called phenotypes. Phenotypes are also dominant or recessive. These traits have many different variations that prove natural selection, "survival of the fittest", and evolution. The variations in traits can be found in proteins, DNA, and genes, and are the biochemical evidence of natural selection. In order to find the frequency of the gene and the percent population, two people Godfrey H. Hardy and Wilhelm Weinberg created a formula to solve that, creatively named the Hardy-Weinberg Principle.

Hardy and Weinberg looked at the dominant and recessive alleles in genes and created an equation that had an uncanny resemblance to the Pythagorean Theorem. (Come on you guys. The Pythagorean Theorem is so three thousand years ago.)

By using this theorem, one can find the frequency of the gene and percent population of the gene in a population. ( I would give examples, but blogger won't let me up equations in...)

Now here's the awkward part. In order to test genetic frequency and percent populations, the class was given four flash cards each, two with a capital 'A' and two with a lower case 'a'. We were then told to exchange two card each to create an offspring, thus "mating" with one another. 

To make things worse, there was mood music playing. The music fell into the same category of songs like "Let's Get it On", "Careless Whisper", and "Business Time". 

I learned three things from that.

1. I'm an awkward dancer
2. "Mating" is not my thing.
3. Evolution occurs when there is change in the genotype of a population. 

To go further into depth on number three, as we continued "mating" and such, there were less and less people with the 'aa' or recessive gene and more and more people with either the 'AA' or 'Aa' dominant gene. The species were slowly adapting to the environment that surrounded them so that more can live. 

And that my friends, is evolution in a nutshell.

So I've got a test next class and I know I said last time that next time I'll start studying before the night before the test...but a nasty AP U.S. History test and a dreadful AP Lang essay got in the way of that. So, yay cramming!!

Until next time.